Covid-19 vaccine thread

WolfEyes

Well-known member
Joined
Sep 20, 2018
Messages
397
SL Rez
2004
Joined SLU
2009
This doesn't really help me, because there are no standalone Krispy Kreme locations in my part of the state - and even if there were, I literally don't think I could eat a doughnut every single day. But, here you go:

There used to be on one Jackson Ext on the right side going towards Horseshoe Dr. It was before you got to ASH.
 

Argent Stonecutter

Emergency Mustelid Hologram
Joined
Sep 20, 2018
Messages
2,702
Location
Coonspiracy Central, Noonkkot
SL Rez
2005
Joined SLU
Sep 2009
SLU Posts
20780
Where are you, Wolfeyes? Texas is opening up vaccines to everyone over 16 tomorrow.
 
Joined
Sep 19, 2018
Messages
3,010
Location
Portland, OR
SL Rez
2003
SLU Posts
4494
Over 60. ✅
Compromised immune system. ✅
Qualifies for vaccine. ❌

Fuck it.
You might want to check this out.

 
  • 2Like
Reactions: Pamela and WolfEyes

WolfEyes

Well-known member
Joined
Sep 20, 2018
Messages
397
SL Rez
2004
Joined SLU
2009
You might want to check this out.

Thanks. Now if I just had some way to get across two counties to get there. 🤔
 

Bartholomew Gallacher

Well-known member
Joined
Sep 26, 2018
Messages
3,000
SL Rez
2002
This here is the Biontech/Pfizer vaccine:

GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCA
GCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCCTCCAGCCTACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTT
CAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCACGTGTCCGGCACC
AATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCT
GGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCA
GTTCTGCAACGACCCCTTCCTGGGCGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAAC
AACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTA
AGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACC
CCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGC
AGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCA
CCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAG
CAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGA
TTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCT
TCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGT
GCGGCAGATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAAC
AGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACCTGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACA
TCTCCACCGAGATCTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTCCCACTGCAGTCCTACGGCTTTCA
GCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAG
AAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGT
TCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCC
TTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGACGTGAACTGTACCGAA
GTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTC
TGATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAACAG
CCCTCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAAC
TCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGT
ACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCGC
CGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAAT
TTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCG
GCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCC
TCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCC
GCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGA
TCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAA
CCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAACTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGA
CTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCA
GAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGG
CAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAAT
TTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGA
CACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAA
TACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGAC
CTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGC
CATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTC
GACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCT
GCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGC
TAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTT
AGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA

This here is the Moderna vaccine:
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGA
GCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCCACCAGCCTACACCAACAGCTTCACCCGGGGCGTCTACTACCCCGACAAGGT
GTTCCGGAGCAGCGTCCTGCACAGCACCCAGGACCTGTTCCTGCCCTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCACGTGAGCGGC
ACCAACGGCACCAAGCGGTTCGACAACCCCGTGCTGCCCTTCAACGACGGCGTGTACTTCGCCAGCACCGAGAAGAGCAACATCATCCGGG
GCTGGATCTTCGGCACCACCCTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAATAACGCCACCAACGTGGTGATCAAGGTGTGCGAGTT
CCAGTTCTGCAACGACCCCTTCCTGGGCGTGTACTACCACAAGAACAACAAGAGCTGGATGGAGAGCGAGTTCCGGGTGTACAGCAGCGCC
AACAACTGCACCTTCGAGTACGTGAGCCAGCCCTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGCGGGAGTTCGTGT
TCAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCAATCAACCTGGTGCGGGATCTGCCCCAGGGCTTCTCAGCCCTGGA
GCCCCTGGTGGACCTGCCCATCGGCATCAACATCACCCGGTTCCAGACCCTGCTGGCCCTGCACCGGAGCTACCTGACCCCAGGCGACAGC
AGCAGCGGGTGGACAGCAGGCGCGGCTGCTTACTACGTGGGCTACCTGCAGCCCCGGACCTTCCTGCTGAAGTACAACGAGAACGGCACCA
TCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCAAGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGAC
CAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACC
CGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCA
CCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCGACGA
GGTGCGGCAGATCGCACCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGG
AACAGCAACAACCTCGACAGCAAGGTGGGCGGCAACTACAACTACCTGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGG
ACATCAGCACCGAGATCTACCAAGCCGGCTCCACCCCTTGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCCTCTGCAGAGCTACGGCTT
CCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCC
AAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAACGGCCTTACCGGCACCGGCGTGCTGACCGAGAGCAACAAGA
AATTCCTGCCCTTTCAGCAGTTCGGCCGGGACATCGCCGACACCACCGACGCTGTGCGGGATCCCCAGACCCTGGAGATCCTGGACATCAC
CCCTTGCAGCTTCGGCGGCGTGAGCGTGATCACCCCAGGCACCAACACCAGCAACCAGGTGGCCGTGCTGTACCAGGACGTGAACTGCACC
GAGGTGCCCGTGGCCATCCACGCCGACCAGCTGACACCCACCTGGCGGGTCTACAGCACCGGCAGCAACGTGTTCCAGACCCGGGCCGGTT
GCCTGATCGGCGCCGAGCACGTGAACAACAGCTACGAGTGCGACATCCCCATCGGCGCCGGCATCTGTGCCAGCTACCAGACCCAGACCAA
TTCACCCCGGAGGGCAAGGAGCGTGGCCAGCCAGAGCATCATCGCCTACACCATGAGCCTGGGCGCCGAGAACAGCGTGGCCTACAGCAAC
AACAGCATCGCCATCCCCACCAACTTCACCATCAGCGTGACCACCGAGATTCTGCCCGTGAGCATGACCAAGACCAGCGTGGACTGCACCA
TGTACATCTGCGGCGACAGCACCGAGTGCAGCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAACCGGGCCCTGACCGGCAT
CGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACCCCTCCCATCAAGGACTTCGGCGGCTTC
AACTTCAGCCAGATCCTGCCCGACCCCAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAGGTGACCCTAGCCGACG
CCGGCTTCATCAAGCAGTACGGCGACTGCCTCGGCGACATAGCCGCCCGGGACCTGATCTGCGCCCAGAAGTTCAACGGCCTGACCGTGCT
GCCTCCCCTGCTGACCGACGAGATGATCGCCCAGTACACCAGCGCCCTGTTAGCCGGAACCATCACCAGCGGCTGGACTTTCGGCGCTGGA
GCCGCTCTGCAGATCCCCTTCGCCATGCAGATGGCCTACCGGTTCAACGGCATCGGCGTGACCCAGAACGTGCTGTACGAGAACCAGAAGC
TGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACCGCTAGCGCCCTGGGCAAGCTGCAGGACGTGGT
GAACCAGAACGCCCAGGCCCTGAACACCCTGGTGAAGCAGCTGAGCAGCAACTTCGGCGCCATCAGCAGCGTGCTGAACGACATCCTGAGC
CGGCTGGACCCTCCCGAGGCCGAGGTGCAGATCGACCGGCTGATCACTGGCCGGCTGCAGAGCCTGCAGACCTACGTGACCCAGCAGCTGA
TCCGGGCCGCCGAGATTCGGGCCAGCGCCAACCTGGCCGCCACCAAGATGAGCGAGTGCGTGCTGGGCCAGAGCAAGCGGGTGGACTTCTG
CGGCAAGGGCTACCACCTGATGAGCTTTCCCCAGAGCGCACCCCACGGAGTGGTGTTCCTGCACGTGACCTACGTGCCCGCCCAGGAGAAG
AACTTCACCACCGCCCCAGCCATCTGCCACGACGGCAAGGCCCACTTTCCCCGGGAGGGCGTGTTCGTGAGCAACGGCACCCACTGGTTCG
TGACCCAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGAGCGGCAACTGCGACGTGGTGATCGGCATCGTGAA
CAACACCGTGTACGATCCCCTGCAGCCCGAGCTGGACAGCTTCAAGGAGGAGCTGGACAAGTACTTCAAGAATCACACCAGCCCCGACGTG
GACCTGGGCGACATCAGCGGCATCAACGCCAGCGTGGTGAACATCCAGAAGGAGATCGATCGGCTGAACGAGGTGGCCAAGAACCTGAACG
AGAGCCTGATCGACCTGCAGGAGCTGGGCAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTCATCGCCGGCCTGAT
CGCCATCGTGATGGTGACCATCATGCTGTGCTGCATGACCAGCTGCTGCAGCTGCCTGAAGGGCTGTTGCAGCTGCGGCAGCTGCTGCAAG
TTCGACGAGGACGACAGCGAGCCCGTGCTGAAGGGCGTGAAGCTGCACTACACCTGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTG
CCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCAAAAAAAAA

Source: NAalytics/Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273
 
Joined
Sep 19, 2018
Messages
3,010
Location
Portland, OR
SL Rez
2003
SLU Posts
4494
This here is the Biontech/Pfizer vaccine:

GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCA
GCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCCTCCAGCCTACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTT
CAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCACGTGTCCGGCACC
AATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCT
GGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCA
GTTCTGCAACGACCCCTTCCTGGGCGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAAC
AACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTA
AGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACC
CCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGC
AGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCA
CCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAG
CAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGA
TTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCT
TCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGT
GCGGCAGATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAAC
AGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACCTGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACA
TCTCCACCGAGATCTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTCCCACTGCAGTCCTACGGCTTTCA
GCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAG
AAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGT
TCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCC
TTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGACGTGAACTGTACCGAA
GTGCCCGTGGCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTC
TGATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAACAG
CCCTCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAAC
TCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGT
ACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCGC
CGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAAT
TTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCG
GCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCC
TCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCC
GCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGA
TCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAA
CCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAACTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGA
CTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCA
GAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGG
CAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAAT
TTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGA
CACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAA
TACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGAC
CTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGC
CATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTC
GACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCT
GCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGC
TAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTT
AGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA

This here is the Moderna vaccine:
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGA
GCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCCACCAGCCTACACCAACAGCTTCACCCGGGGCGTCTACTACCCCGACAAGGT
GTTCCGGAGCAGCGTCCTGCACAGCACCCAGGACCTGTTCCTGCCCTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCACGTGAGCGGC
ACCAACGGCACCAAGCGGTTCGACAACCCCGTGCTGCCCTTCAACGACGGCGTGTACTTCGCCAGCACCGAGAAGAGCAACATCATCCGGG
GCTGGATCTTCGGCACCACCCTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAATAACGCCACCAACGTGGTGATCAAGGTGTGCGAGTT
CCAGTTCTGCAACGACCCCTTCCTGGGCGTGTACTACCACAAGAACAACAAGAGCTGGATGGAGAGCGAGTTCCGGGTGTACAGCAGCGCC
AACAACTGCACCTTCGAGTACGTGAGCCAGCCCTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGCGGGAGTTCGTGT
TCAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCAATCAACCTGGTGCGGGATCTGCCCCAGGGCTTCTCAGCCCTGGA
GCCCCTGGTGGACCTGCCCATCGGCATCAACATCACCCGGTTCCAGACCCTGCTGGCCCTGCACCGGAGCTACCTGACCCCAGGCGACAGC
AGCAGCGGGTGGACAGCAGGCGCGGCTGCTTACTACGTGGGCTACCTGCAGCCCCGGACCTTCCTGCTGAAGTACAACGAGAACGGCACCA
TCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCAAGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGAC
CAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACC
CGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCA
CCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCGACGA
GGTGCGGCAGATCGCACCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGG
AACAGCAACAACCTCGACAGCAAGGTGGGCGGCAACTACAACTACCTGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGG
ACATCAGCACCGAGATCTACCAAGCCGGCTCCACCCCTTGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCCTCTGCAGAGCTACGGCTT
CCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCC
AAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAACGGCCTTACCGGCACCGGCGTGCTGACCGAGAGCAACAAGA
AATTCCTGCCCTTTCAGCAGTTCGGCCGGGACATCGCCGACACCACCGACGCTGTGCGGGATCCCCAGACCCTGGAGATCCTGGACATCAC
CCCTTGCAGCTTCGGCGGCGTGAGCGTGATCACCCCAGGCACCAACACCAGCAACCAGGTGGCCGTGCTGTACCAGGACGTGAACTGCACC
GAGGTGCCCGTGGCCATCCACGCCGACCAGCTGACACCCACCTGGCGGGTCTACAGCACCGGCAGCAACGTGTTCCAGACCCGGGCCGGTT
GCCTGATCGGCGCCGAGCACGTGAACAACAGCTACGAGTGCGACATCCCCATCGGCGCCGGCATCTGTGCCAGCTACCAGACCCAGACCAA
TTCACCCCGGAGGGCAAGGAGCGTGGCCAGCCAGAGCATCATCGCCTACACCATGAGCCTGGGCGCCGAGAACAGCGTGGCCTACAGCAAC
AACAGCATCGCCATCCCCACCAACTTCACCATCAGCGTGACCACCGAGATTCTGCCCGTGAGCATGACCAAGACCAGCGTGGACTGCACCA
TGTACATCTGCGGCGACAGCACCGAGTGCAGCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAACCGGGCCCTGACCGGCAT
CGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACCCCTCCCATCAAGGACTTCGGCGGCTTC
AACTTCAGCCAGATCCTGCCCGACCCCAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAGGTGACCCTAGCCGACG
CCGGCTTCATCAAGCAGTACGGCGACTGCCTCGGCGACATAGCCGCCCGGGACCTGATCTGCGCCCAGAAGTTCAACGGCCTGACCGTGCT
GCCTCCCCTGCTGACCGACGAGATGATCGCCCAGTACACCAGCGCCCTGTTAGCCGGAACCATCACCAGCGGCTGGACTTTCGGCGCTGGA
GCCGCTCTGCAGATCCCCTTCGCCATGCAGATGGCCTACCGGTTCAACGGCATCGGCGTGACCCAGAACGTGCTGTACGAGAACCAGAAGC
TGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACCGCTAGCGCCCTGGGCAAGCTGCAGGACGTGGT
GAACCAGAACGCCCAGGCCCTGAACACCCTGGTGAAGCAGCTGAGCAGCAACTTCGGCGCCATCAGCAGCGTGCTGAACGACATCCTGAGC
CGGCTGGACCCTCCCGAGGCCGAGGTGCAGATCGACCGGCTGATCACTGGCCGGCTGCAGAGCCTGCAGACCTACGTGACCCAGCAGCTGA
TCCGGGCCGCCGAGATTCGGGCCAGCGCCAACCTGGCCGCCACCAAGATGAGCGAGTGCGTGCTGGGCCAGAGCAAGCGGGTGGACTTCTG
CGGCAAGGGCTACCACCTGATGAGCTTTCCCCAGAGCGCACCCCACGGAGTGGTGTTCCTGCACGTGACCTACGTGCCCGCCCAGGAGAAG
AACTTCACCACCGCCCCAGCCATCTGCCACGACGGCAAGGCCCACTTTCCCCGGGAGGGCGTGTTCGTGAGCAACGGCACCCACTGGTTCG
TGACCCAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGAGCGGCAACTGCGACGTGGTGATCGGCATCGTGAA
CAACACCGTGTACGATCCCCTGCAGCCCGAGCTGGACAGCTTCAAGGAGGAGCTGGACAAGTACTTCAAGAATCACACCAGCCCCGACGTG
GACCTGGGCGACATCAGCGGCATCAACGCCAGCGTGGTGAACATCCAGAAGGAGATCGATCGGCTGAACGAGGTGGCCAAGAACCTGAACG
AGAGCCTGATCGACCTGCAGGAGCTGGGCAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTCATCGCCGGCCTGAT
CGCCATCGTGATGGTGACCATCATGCTGTGCTGCATGACCAGCTGCTGCAGCTGCCTGAAGGGCTGTTGCAGCTGCGGCAGCTGCTGCAAG
TTCGACGAGGACGACAGCGAGCCCGTGCTGAAGGGCGTGAAGCTGCACTACACCTGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTG
CCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCAAAAAAAAA

Source: NAalytics/Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273
They both have around 40 to 50 CATs so they're both ok by me.
 

Free

Antifa-tigued
VVO Supporter 🍦🎈👾❤
Joined
Sep 22, 2018
Messages
18,287
Location
Moonbase Caligula
SL Rez
2008
Joined SLU
2009
SLU Posts
55565


God, I WISH!
 

Aribeth Zelin

Faeryfox
Joined
Sep 23, 2018
Messages
2,696
SL Rez
2004
Joined SLU
03-11-2011
SLU Posts
9410
Figures they got their insult ass-backwards, anyway. The ones being discriminated against were the ones who had to wear the identifying patches.
Doesn't sound like they know that.
Yes, but it does make clear that on some level they know who the fascists are.
 
  • 1Agree
Reactions: Katheryne Helendale